Stem-loop sequence ame-mir-6006

AccessionMI0020217 (change log)
DescriptionApis mellifera miR-6006 stem-loop
Stem-loop
   caacc    cuagg ug  aaaa        g         gaau 
5'      cucg     g  ag    auaacugg aagagagag    a
        ||||     |  ||    |||||||| |||||||||     
3'      gagc     c  uu    uauugacu uuuucuuuu    a
   uuaaa    --uua gu  -gaa        -         aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 171756-171843 [+]
intergenic
Database links

Mature sequence ame-miR-6006-5p

Accession MIMAT0023553
Sequence

24 - 

auaacugggaagagagagg

 - 42

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ame-miR-6006-3p

Accession MIMAT0023554
Sequence

51 - 

auuuucuuuuucaguuauaa

 - 70

Get sequence
Evidence experimental; SOLiD [1], Illumina [3]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).