Stem-loop sequence dpr-MIR156b

AccessionMI0020198
DescriptionDigitalis purpurea miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   a            --a            gcaggcuaauu       uguu 
5'  gugugacagaag   gagugagcacac           guauacg    u
    ||||||||||||   ||||||||||||           |||||||     
3'  cacacugucuuu   uucacucgugug           cauaugu    c
   a            cug            -----------       uuuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence dpr-miR156b

Accession MIMAT0023527
Sequence

5 - 

ugacagaagagagugagcac

 - 24

Get sequence
Evidence not experimental

References

1