Stem-loop sequence dpr-MIR156a

AccessionMI0020197
DescriptionDigitalis purpurea miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   a      ---         -a      g    g   ggg    u        au 
5'  gggauu   ugacagaag  gaggga caca gca   aaau guauagag  u
    ||||||   |||||||||  |||||| |||| |||   |||| ||||||||  a
3'  ccuuaa   acugucuuc  uucccu gugu cgu   uuug cauauuuu  g
   a      ucg         cc      a    g   --a    -        gu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence dpr-miR156a

Accession MIMAT0023526
Sequence

8 - 

ugacagaagagagggagcac

 - 27

Get sequence
Evidence experimental; 454 [1]

References

1