Stem-loop sequence hco-mir-5886b

AccessionMI0020130 (change log)
DescriptionHaemonchus contortus miR-5886b stem-loop
Gene family MIPF0001638; mir-5886
Stem-loop
   -----cuuuuuau       ---u  g       ug -    uu  u         uuc 
5'              auugcau    uu uucaaac  a guca  ga guguucuug   a
                |||||||    || |||||||  | ||||  || |||||||||    
3'              uaacgua    aa aaguuug  u cagu  cu cacaagaau   a
   uaagauccuagac       uauu  g       gu u    uu  -         cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5886b

Accession MIMAT0023462
Sequence

59 - 

gaacacucuuugacuuugguuuga

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).