Stem-loop sequence hco-mir-46

AccessionMI0020003 (change log)
DescriptionHaemonchus contortus miR-46 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   ------ugccaugu    -ac  u  -           -cg     u      -  ac 
5'               ggau   gg ag cugaagagagc   uccgu gacagu uc  u
                 ||||   || || |||||||||||   ||||| |||||| ||   
3'               ccua   cc uc gacuucucucg   aggua cugucg ag  a
   cacccguuuaagug    gau  -  a           cug     -      c  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-46

Accession MIMAT0023327
Sequence

58 - 

ugucauggagucgcucucuuca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).