Stem-loop sequence osa-MIR5516b

AccessionMI0019859 (change log)
DescriptionOryza sativa miR5516b stem-loop
Gene family MIPF0001595; MIR5516
Literature search

2 open access papers mention osa-MIR5516b
(3 sentences)

Stem-loop
     -       -   u  g      aagca     aaa 
5' uc ucaguuu ccg gg agugag     ugggg   u
   || ||||||| ||| || ||||||     |||||    
3' ag ggucgga ggc uc uuacuc     auccc   u
     c       u   u  g      -----     gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 13962666-13962734 [-]
intergenic
Database links

Mature sequence osa-miR5516b

Accession MIMAT0023315
Sequence

46 - 

cucauugcuucgguaggcugg

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).