Stem-loop sequence osa-MIR2873c

AccessionMI0019856 (change log)
DescriptionOryza sativa miR2873c stem-loop
Gene family MIPF0001679; MIR2873
Literature search

2 open access papers mention osa-MIR2873c
(2 sentences)

Stem-loop
   uua     a           ---             aag                      ac 
5'    ccaaa cucaacuuuau   augggaguaaaaa   gauaaauuucgggugaauagug  a
      ||||| |||||||||||   |||||||||||||   ||||||||||||||||||||||   
3'    gguuu gaguugaagua   uaucuuuguuuuu   uuguuuaaaguuuacuuauuau  g
   aca     -           aac             --a                      gg 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 27503433-27503554 [+]
intergenic
Database links

Mature sequence osa-miR2873c

Accession MIMAT0023311
Sequence

101 - 

caaaugaaguugaguuuggac

 - 121

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).