Stem-loop sequence osa-MIR5835

AccessionMI0019855 (change log)
DescriptionOryza sativa miR5835 stem-loop
Literature search

1 open access papers mention osa-MIR5835
(3 sentences)

Stem-loop
   ua    ---------          -    -    a     g      a      uaauauuaguauuauguauuaugguucuaaaauuucacaaaaccacaaacguuaaccaauuuuacauacuuccauacuaau 
5'   caag         uuguacgaaa ccau aggg uuuug caugug cauaua                                                                                 a
     ||||         |||||||||| |||| |||| ||||| |||||| ||||||                                                                                  
3'   guuc         aacguguuuu ggug uccc aaaau guacac guguau                                                                                 a
   -g    ucauuugaa          u    a    -     g      c      ugguucaaaguguuuuggugugauauguaguaaaaaugaaauuagauagugugaaaacacaagauauuaguguagacuuua 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 19306710-19306970 [-]
intergenic
Database links

Mature sequence osa-miR5835

Accession MIMAT0023310
Sequence

11 - 

acgaaaccauagggauuuuggcau

 - 34

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).