Stem-loop sequence osa-MIR5833

AccessionMI0019853 (change log)
DescriptionOryza sativa miR5833 stem-loop
Literature search

1 open access papers mention osa-MIR5833
(1 sentences)

Stem-loop
         au      c       cauc      
5' uccucu  cuccuc ucgggcu    gggcu 
   ||||||  |||||| |||||||    |||| c
3' aggagg  gagggg ggcccga    uccga 
         --      u       -aac      
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 9341240-9341299 [-]
intergenic
Database links

Mature sequence osa-miR5833

Accession MIMAT0023308
Sequence

10 - 

uccuccucgggcucaucgggc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).