Stem-loop sequence osa-MIR5832

AccessionMI0019852 (change log)
DescriptionOryza sativa miR5832 stem-loop
Stem-loop
   ca    ga    u  u  c  aua      ----- u    -  ga   u 
5'   ucag  guug ca gc ac   uccguc     c cacc cu  cca u
     ||||  |||| || || ||   ||||||     | |||| ||  |||  
3'   aguc  cgac gu cg ug   aggcgg     g gugg ga  ggu a
   -g    -a    u  -  u  gcg      uuuac c    a  --   g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 21168996-21169086 [+]
intergenic
Database links

Mature sequence osa-miR5832

Accession MIMAT0023307
Sequence

63 - 

uuggcggagcgguugcuguca

 - 83

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).