Stem-loop sequence osa-MIR5179

AccessionMI0019851 (change log)
DescriptionOryza sativa miR5179 stem-loop
Gene family MIPF0001641; MIR5179
Literature search

2 open access papers mention osa-MIR5179
(3 sentences)

Stem-loop
         ----      -    u     -         g  -u     uga  c            c         auguucauccagagccccuguugaucuucagauaagagaa 
5' uugaga    ggcguu uugc caaga ccgcgcaac au  ccaua   ca cgcaucguuguc augccuauc                                        a
   ||||||    |||||| |||| ||||| ||||||||| ||  |||||   || |||||||||||| |||||||||                                         
3' agcucu    uugcaa aacg guucu ggcguguug ua  gguau   gu gcguagcggcag uauggauag                                        a
         aguu      u    c     u         g  cc     -cg  c            c         gaacuguacuaguuauuuguucggaagaaauuaaaacucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 12450910-12451133 [+]
intergenic
Database links

Mature sequence osa-miR5179

Accession MIMAT0023306
Sequence

11 - 

uuuugcucaagaccgcgcaac

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).