Stem-loop sequence osa-MIR5828

AccessionMI0019847 (change log)
DescriptionOryza sativa miR5828 stem-loop
Stem-loop
                        a                  u    -aaa  uaag 
5' aaguaacuuguuacggcauua aaguaaaucuauuguggg uuag    ca    u
   ||||||||||||||||||||| |||||||||||||||||| ||||    ||     
3' uucauugaacaguguuguaau uucauuuagguaacaccc aauu    gu    c
                        c                  c    aaag  uuau 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 16015691-16015801 [+]
intergenic
Database links

Mature sequence osa-miR5828

Accession MIMAT0023302
Sequence

11 - 

uuacggcauuaaaaguaaauc

 - 31

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).