Stem-loop sequence osa-MIR5827

AccessionMI0019846 (change log)
DescriptionOryza sativa miR5827 stem-loop
Literature search

1 open access papers mention osa-MIR5827
(1 sentences)

Stem-loop
         cac          a           cua   - a     uc   a   -caauu  agcccaccggugaacuccuccaccucu 
5' uauuuu   cuuuguugca uuuggacuacc   aac c cuucu  agc cau      cc                           u
   ||||||   |||||||||| |||||||||||   ||| | |||||  ||| |||      ||                            
3' auaaaa   gaaacaacgu aaaccuggugg   uug g gaagg  ucg gua      gg                           u
         aau          g           -ag   a a     ga   -   cagacc  agaggaggucguuucuauacuuagacg 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 30081902-30082077 [-]
intergenic
Database links

Mature sequence osa-miR5827

Accession MIMAT0023301
Sequence

11 - 

uuuguugcaauuuggacuacc

 - 31

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).