Stem-loop sequence osa-MIR1319b

AccessionMI0019843 (change log)
DescriptionOryza sativa miR1319b stem-loop
Gene family MIPF0001448; MIR1319
Literature search

3 open access papers mention osa-MIR1319b
(3 sentences)

Stem-loop
                   u         c       u    a                aaa 
5' auaggugccgguuuuu aaaaaaacc gacaccu uaau uauuauaggugucggu   u
   |||||||||||||||| ||||||||| ||||||| |||| ||||||||||||||||   u
3' uguccacggccaaaaa uuuuuuugg cugugga auua auaauauccacggcua   a
                   -         -       u    a                aaa 
Get sequence
Deep sequencing
156 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 23399893-23400011 [+]
intergenic
Database links

Mature sequence osa-miR1319b

Accession MIMAT0023298
Sequence

32 - 

ccuuuaauauauuauaggugucgg

 - 55

Get sequence
Deep sequencing117 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).