Stem-loop sequence osa-MIR5824

AccessionMI0019842 (change log)
DescriptionOryza sativa miR5824 stem-loop
Gene family MIPF0000343; MIR806
Stem-loop
   u             a      a        c  guuuaauc                  auuuacguaauuauaaucuauuuuauugugaguuguuuuaucac 
5'  uaauagauaacgc auugac uuuuauca ac        auucaucuuauuuaaaaa                                            u
    ||||||||||||| |||||| |||||||| ||        ||||||||||||||||||                                             
3'  auuaucuauugcg uaacug agaauagu ug        uaaguagaauaaguuuuu                                            u
   a             g      a        c  -------a                  aaaauauauuuauguauucuaaacuuagugcuuauuuuaugaaa 
Get sequence
Deep sequencing
775 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 1761530-1761730 [-]
intergenic
Database links

Mature sequence osa-miR5824

Accession MIMAT0023297
Sequence

168 - 

agucugauaagaagucaauggcgu

 - 191

Get sequence
Deep sequencing18 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).