Stem-loop sequence osa-MIR5817

AccessionMI0019835 (change log)
DescriptionOryza sativa miR5817 stem-loop
Literature search

1 open access papers mention osa-MIR5817
(1 sentences)

Stem-loop
   aac   u     c   uu   a  aaa     auacgagaggauauccccuugagggauuagaauccacucccua 
5'    uau ugcau gaa  uga ag   aaggu                                           u
      ||| ||||| |||  ||| ||   |||||                                            
3'    gua acgug cuu  acu uc   uuuca                                           a
   uuc   c     c   uu   c  acc     acauuucgagauguuugcuuguguuggaauuagguaaucucga 
Get sequence
Deep sequencing
116 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 5990125-5990276 [+]
intergenic
Database links

Mature sequence osa-miR5817

Accession MIMAT0023290
Sequence

11 - 

aucgaauuugaaagaaaaagguau

 - 34

Get sequence
Deep sequencing108 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).