Stem-loop sequence osa-MIR5143b

AccessionMI0019834 (change log)
DescriptionOryza sativa miR5143b stem-loop
Gene family MIPF0001617; MIR5143
Literature search

2 open access papers mention osa-MIR5143b
(2 sentences)

Stem-loop
   ugac   u      -      a            ca   u    ug  g  cgcauguugcccuguuuaccacuauuaaucaagacacucccccuc 
5'     uca gcuucc auguug ccaacauaccac  aaa auua  au uu                                             c
       ||| |||||| |||||| ||||||||||||  ||| ||||  || ||                                              
3'     agu ugaagg uguaac gguuguauggug  uuu uaau  ug aa                                             u
   ggua   c      a      -            uc   -    gu  g  ucggacaaaugguuauauaacuacaagugguccuuuuguuuucuc 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 8415808-8415998 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5143b
osa-MIR5143aChr1: 8417107-8417315 [-]
osa-MIR5143bChr1: 8415808-8415998 [-]
Database links

Mature sequence osa-miR5143b

Accession MIMAT0023289
Sequence

158 - 

ugugguauguuggcaauguaggaa

 - 181

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).