Stem-loop sequence osa-MIR5815

AccessionMI0019832 (change log)
DescriptionOryza sativa miR5815 stem-loop
Literature search

1 open access papers mention osa-MIR5815
(1 sentences)

Stem-loop
   -aauguauuaaa    aug               agg      gaugg    a    uu 
5'             uguu   gacacuagaugacau   guugau     ucua uaug  g
               ||||   |||||||||||||||   ||||||     |||| ||||   
3'             acaa   cugugguuuacugug   uaauua     agau guau  u
   uuaacuuugaaa    -aa               ---      ---aa    a    uc 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 25017304-25017415 [-]
intergenic
Database links

Mature sequence osa-miR5815

Accession MIMAT0023287
Sequence

10 - 

aauguuauggacacuagaugacau

 - 33

Get sequence
Deep sequencing98 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).