Stem-loop sequence osa-MIR5812

AccessionMI0019829 (change log)
DescriptionOryza sativa miR5812 stem-loop
Literature search

1 open access papers mention osa-MIR5812
(2 sentences)

Stem-loop
        a    u          g      ug 
5' uagca cgau uuaagauugu gcaaua  u
   ||||| |||| |||||||||| ||||||   
3' aucgu guua aauuuuaaua cguuau  a
        a    c          a      cu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 11846139-11846200 [-]
intergenic
Database links

Mature sequence osa-miR5812

Accession MIMAT0023284
Sequence

2 - 

agcaacgauuuuaagauuguggca

 - 25

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).