Stem-loop sequence osa-MIR5807

AccessionMI0019824 (change log)
DescriptionOryza sativa miR5807 stem-loop
Literature search

1 open access papers mention osa-MIR5807
(1 sentences)

Stem-loop
   -                 c                    agcca           g    g             uaacugaaacaucccuuauaaguuauuuuuagggaacaaacccuuauaaguaaucacacuucauaaugaggcacauuacuccucuaacugaaacaucccuuaua 
5'  aucugaaaguaggaggu uggagaguuauguggcagga     agccaggaaau uaau uaaucgacagcuc                                                                                                        a
    ||||||||||||||||| ||||||||||||||||||||     ||||||||||| |||| |||||||||||||                                                                                                        g
3'  uagacuuuuauccuccg accucucaauacacuguccu     ucgguccuuua auua auuagcugucgag                                                                                                        u
   u                 c                    -----           g    g             uguacauccaguacuacuaguuagauagguguaacuaaaauaucuacucauuacacggaguaauacuucacacuaaugaauauucccaaacaagggauuuuuau 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 3597497-3597849 [-]
intergenic
Database links

Mature sequence osa-miR5807

Accession MIMAT0023279
Sequence

11 - 

aggaggucuggagaguuauguggc

 - 34

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).