Stem-loop sequence osa-MIR812v

AccessionMI0019823 (change log)
DescriptionOryza sativa miR812v stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812v
(15 sentences)

Stem-loop
   ac   a  -          a   u    aaa    a     cc   c          c    ua        aaauuuuuuuuauaauuaguauuuuuguuguuaugagaugauaa 
5'   ugc uc cuccguucca uuu agug   ccau aguuu  gug uuaauuuuaa uguu  uuuuauuu                                            a
     ||| || |||||||||| ||| ||||   |||| |||||  ||| |||||||||| ||||  ||||||||                                             
3'   aug ag gaggcagggu aaa ucac   ggua ucaaa  uau gauugaaauu gcag  aaaauaaa                                            a
   uc   -  a          a   u    guc    c     aa   a          a    ga        cuuuuuuuuauuuuuguauucagugcguauuucauuaugaauac 
Get sequence
Deep sequencing
824 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 18432835-18433066 [-]
intergenic
Database links

Mature sequence osa-miR812v

Accession MIMAT0023278
Sequence

199 - 

auggcugcacuuaaaaugggacgg

 - 222

Get sequence
Deep sequencing646 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).