Stem-loop sequence osa-MIR5806

AccessionMI0019822 (change log)
DescriptionOryza sativa miR5806 stem-loop
Literature search

3 open access papers mention osa-MIR5806
(3 sentences)

Stem-loop
   gg    --      -    u ga  a   --ga     -aa u 
5'   gucc  gagcug cauu g  uu gcc    ucugg   g u
     ||||  |||||| |||| |  || |||    |||||   |  
3'   uagg  cucggc guaa c  aa cgg    agauu   c a
   ug    uu      a    - ag  a   acaa     gaa g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 24708626-24708706 [+]
intergenic
Database links

Mature sequence osa-miR5806

Accession MIMAT0023277
Sequence

51 - 

acaggcaaagacaaugacggc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).