Stem-loop sequence osa-MIR5805

AccessionMI0019821 (change log)
DescriptionOryza sativa miR5805 stem-loop
Literature search

1 open access papers mention osa-MIR5805
(1 sentences)

Stem-loop
   -  a          a   a         a         ga       ----      a  ---a    -aca               gc       -c  g    a  accuccaagacguugcggcacuuguucugcucaauacacaagcaaaauaaugaggauagcuagcguuuggggaugggccaggcggccaacaugacgaggua 
5'  cg caucagcacg gug uggcggcgu uaccugcgg  aggcggc    ggcggc ug    aggu    ggggcaagcagcugc  ggcgcag  cu cugg gc                                                                                                     a
    || |||||||||| ||| ||||||||| |||||||||  |||||||    |||||| ||    ||||    |||||||||||||||  |||||||  || |||| ||                                                                                                     u
3'  gu guaguugugc cac gcugccgca guggacguc  uccgcug    cugccg ac    uccg    ccccguucgucgacg  ucgcguc  ga ggcc cg                                                                                                     g
   a  c          c   c         c         --       uagg      c  cacc    ccua               --       ac  g    c  cgcucuucuugaagcuacggucucggacguccgguugacccacagacacaccgguauagguacgucagggugaugaagacggccgcguguucgucgaggua 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 13821490-13821896 [-]
intergenic
Database links

Mature sequence osa-miR5805

Accession MIMAT0023276
Sequence

11 - 

acgagugauggcggcguauaccug

 - 34

Get sequence
Deep sequencing31 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).