Stem-loop sequence osa-MIR812u

AccessionMI0019818 (change log)
DescriptionOryza sativa miR812u stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812u
(15 sentences)

Stem-loop
   u          -       a    aaaa    a  cc               a    -auuu      uuuuau      uauuuuuauuauuaugagauaauaagaca 
5'  guuuuauuuu aagugua ccau    uuuc ug  caauuuugaucguuc ucuu     ggauuu      aauuaa                             u
    |||||||||| ||||||| ||||    |||| ||  ||||||||||||||| ||||     ||||||      ||||||                              
3'  caggguaaaa uucacgu ggua    aagg ac  guugaaacuggcagg agaa     uuugaa      uuaauu                             g
   a          a       c    cuaa    c  ua               c    aauuu      -uuuuu      uuugcauucaauguuuauuucauugauaa 
Get sequence
Deep sequencing
1847 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 8663581-8663797 [-]
intergenic
Database links

Mature sequence osa-miR812u

Accession MIMAT0023273
Sequence

184 - 

acggaaaaucauggcugcacuuaa

 - 207

Get sequence
Deep sequencing747 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).