Stem-loop sequence osa-MIR812t

AccessionMI0019817 (change log)
DescriptionOryza sativa miR812t stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812t
(15 sentences)

Stem-loop
   u      c          aaa      g     -ua cg            c              uuuuuuuauaauuaguauuuuuacuguuaugagaugauaaagcau 
5'  auguuc auuuuaagug   ccauga uuuuu   c  aacuuugauugu ugucuuauuugaaa                                             g
    |||||| ||||||||||   |||||| |||||   |  |||||||||||| ||||||||||||||                                              
3'  uacaag uaaaauucac   gguacu aaagg   g  uugaaacuagca gcagaauaaacuuu                                             a
   -      a          guc      a     cac au            a              uuuuaaacuuuuuuaauuuucguauucaguacguauuucauaaua 
Get sequence
Deep sequencing
4473 reads, 950 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 17370227-17370448 [-]
intergenic
Database links

Mature sequence osa-miR812t

Accession MIMAT0023272
Sequence

189 - 

acggaaaaucauggcugcacuuaa

 - 212

Get sequence
Deep sequencing888 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).