Stem-loop sequence osa-MIR5802

AccessionMI0019816 (change log)
DescriptionOryza sativa miR5802 stem-loop
Literature search

4 open access papers mention osa-MIR5802
(4 sentences)

Stem-loop
      g         g a       a  c   c 
5' agg auauggacu u cuuugua ag gga u
   ||| ||||||||| | ||||||| || ||| c
3' ucc ugugcuugg a ggaauau uc ccu u
      g         g -       a  c   u 
Get sequence
Deep sequencing
233 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 13088727-13088790 [+]
intergenic
Database links

Mature sequence osa-miR5802

Accession MIMAT0023271
Sequence

7 - 

auggacuguacuuuguaaagcgga

 - 30

Get sequence
Deep sequencing229 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).