Stem-loop sequence osa-MIR812s

AccessionMI0019812 (change log)
DescriptionOryza sativa miR812s stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812s
(17 sentences)

Stem-loop
   u      uc    a    --a    c            u         augaaaaaauuaaaaaaaucacacauaaaguacuauuc 
5'  ggguuu  gugu caac   ugau guucgucuuauu gaaaauuuu                                      a
    ||||||  |||| ||||   |||| |||||||||||| |||||||||                                      u
3'  cuuaaa  caca guug   acua caggcagaauaa uuuuuaaga                                      a
   -      ga    g    caa    a            -         aaacacuaaucauaaaaauaauaauaaccuacuauuuu 
Get sequence
Deep sequencing
2776 reads, 750 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 6033231-6033401 [-]
intergenic
Database links

Mature sequence osa-miR812s

Accession MIMAT0023267
Sequence

138 - 

aagacggacaaucaaacguuggac

 - 161

Get sequence
Deep sequencing2675 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).