Stem-loop sequence osa-MIR5797

AccessionMI0019810 (change log)
DescriptionOryza sativa miR5797 stem-loop
Literature search

2 open access papers mention osa-MIR5797
(2 sentences)

Stem-loop
   u     c   uc        uau    u   ug 
5'  cacug ugu  gugggauu   gcag uaa  u
    ||||| |||  ||||||||   |||| |||  c
3'  gugac aua  cauccuag   cguc guu  g
   u     -   uu        --u    c   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 17084767-17084832 [+]
intergenic
Database links

Mature sequence osa-miR5797

Accession MIMAT0023265
Sequence

11 - 

ucgugggauuuaugcaguuaa

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).