Stem-loop sequence osa-MIR5796

AccessionMI0019809 (change log)
DescriptionOryza sativa miR5796 stem-loop
Literature search

3 open access papers mention osa-MIR5796
(5 sentences)

Stem-loop
   gauc     g  a  g  ug gag     uu         ----a  u    g  a   uccucaug     aua     uu   aagcu 
5'     ggcau gg gg uu  g   uugag  uggacaauu     ca gaga uc ccu        gguag   ccugu  ccc     a
       ||||| || || ||  |   |||||  |||||||||     || |||| || |||        |||||   |||||  |||      
3'     ccgua cc cc aa  u   gacuu  acuuguuag     gu uucu ag gga        ccguc   ggacg  ggg     u
   acga     a  g  g  gu -ag     --         gacag  -    g  -   -cacguua     -ga     uu   gauac 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 2672521-2672691 [-]
intergenic
Database links

Mature sequence osa-miR5796

Accession MIMAT0023264
Sequence

141 - 

ucauucaggauugaagccgcc

 - 161

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).