Stem-loop sequence osa-MIR5795

AccessionMI0019808 (change log)
DescriptionOryza sativa miR5795 stem-loop
Literature search

2 open access papers mention osa-MIR5795
(2 sentences)

Stem-loop
   -    auacuga      g    a    -  -g     uc  -gc     -----  -a      augcuaugguuucgucgacgaggcgaacguagguaggagauagagguauauc 
5'  uggu       ugucga gucg guuc cc  gcugc  cg   ccuau     ug  guaugg                                                    a
    ||||       |||||| |||| |||| ||  |||||  ||   |||||     ||  ||||||                                                    a
3'  acca       gcagcu uagc caag gg  cgacg  gu   ggaua     ac  caugcc                                                    a
   c    -------      g    -    c  aa     cu  aca     cagug  aa      ccucuuucaugaaaaauuuguguuuuaacguagauguguguaagagaauacc 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 11103759-11103977 [-]
intergenic
Database links

Mature sequence osa-miR5795

Accession MIMAT0023263
Sequence

11 - 

augucgaggucgaguucccggc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).