Stem-loop sequence osa-MIR812r

AccessionMI0019807 (change log)
DescriptionOryza sativa miR812r stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812r
(16 sentences)

Stem-loop
               a    uu  cacu    a                                  uuu       uuaauauuuuuguuguuauuagauaauaaaacaug 
5' ccuaaaauaagu uagu  ug    guuc ugucuaacguuugaccguucgucuuauuugaaaa   uuuauga                                   a
   |||||||||||| ||||  ||    |||| ||||||||||||||||||||||||||||||||||   |||||||                                   a
3' ggauuuuauuca gucg  au    uaag acagauugcaaacuggcaggcagaauaaauuuuu   aaauauu                                   u
               c    gc  -cuu    c                                  --u       cuuuuaauuuuuuucaaucaguguguauuuuauga 
Get sequence
Deep sequencing
10284 reads, 2.85e+03 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 18809746-18809963 [+]
intergenic
Database links

Mature sequence osa-miR812r

Accession MIMAT0023262
Sequence

180 - 

acguuagacacgaauuucuacggc

 - 203

Get sequence
Deep sequencing1727 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).