Stem-loop sequence osa-MIR5794

AccessionMI0019806 (change log)
DescriptionOryza sativa miR5794 stem-loop
Literature search

3 open access papers mention osa-MIR5794
(3 sentences)

Stem-loop
      c     g    caa       u c      c  u        -          u   a              uacuguuggcauacacacaaccauagaguucaucuucagaaccaaauccacguucuugaaaauaugaggagggugcugcuggaagaacaacaaucgcucaucgugauggcugcccaccauggugaccguagaaacuagcaua 
5' cau gauau gcug   gacuguu g gauucc ca gaaaucca aauauggaaa caa aggcuugaaguaga                                                                                                                                              g
   ||| ||||| ||||   ||||||| | |||||| || |||||||| |||||||||| ||| ||||||||||||||                                                                                                                                              a
3' gua cuaua cgac   cugauga c cuaagg gu cuuuaggu uuauaucuuu guu uucgaacuucaucu                                                                                                                                              a
      c     g    uug       u a      a  c        c          u   a              cguucaggacccaaaguagccacucggaaacaaagacagauaguaccgacggugguuucacugguaucuuugauuuuaucuuuuccaucaaugaacagauaggguugcauuuacuuguuucagugaacucuauagaugaaaa 
Get sequence
Deep sequencing
9865 reads, 6.35e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR5794

Accession MIMAT0023261
Sequence

401 - 

ugaggaaucacuaguagucgu

 - 421

Get sequence
Deep sequencing9379 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).