Stem-loop sequence osa-MIR5793

AccessionMI0019805 (change log)
DescriptionOryza sativa miR5793 stem-loop
Literature search

2 open access papers mention osa-MIR5793
(6 sentences)

Stem-loop
      -c  --        uaca     -   ucgc    c  a 
5' acc  ga  ggacgaga    gugca gca    ggga gg a
   |||  ||  ||||||||    ||||| |||    |||| ||  
3' ugg  cu  ccuguucu    caugu cgu    uccu uc a
      uc  ac        cuuc     g   ---u    -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 24288999-24289076 [+]
intergenic
Database links

Mature sequence osa-miR5793

Accession MIMAT0023260
Sequence

4 - 

cgaggacgagauacagugcag

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).