Stem-loop sequence osa-MIR5791

AccessionMI0019803 (change log)
DescriptionOryza sativa miR5791 stem-loop
Literature search

3 open access papers mention osa-MIR5791
(4 sentences)

Stem-loop
   u      ucaga       g      ---uaga      gca    u     -a   -  a  ag      gg   uu 
5'  gcuggu     uggaaga uaaaau       ucuagu   uugc auguu  ggc cu gg  gcacca  aac  c
    ||||||     ||||||| ||||||       ||||||   |||| |||||  ||| || ||  ||||||  |||   
3'  cgacua     acuuucu guuuua       agauca   gacg uacga  ucg gg cc  cguggu  uug  c
   a      -cuaa       g      cgaccag      gag    u     ag   a  a  -a      --   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 24374418-24374566 [+]
intergenic
Database links

Mature sequence osa-miR5791

Accession MIMAT0023258
Sequence

103 - 

uugcaggagacuagagaccag

 - 123

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).