Stem-loop sequence osa-MIR812q

AccessionMI0019800 (change log)
DescriptionOryza sativa miR812q stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812q
(15 sentences)

Stem-loop
       -  a                      uu  cac     a        a     ac                     uuuaugauuaguauuuuuauugcuauuagauguuaaaacau 
5' uacu cc uccgucucaaaauaagugcagu  ug   uauuc uacuuaac uuuga  guucgucuuauuugaaaauuu                                         a
   |||| || ||||||||||||||||||||||  ||   ||||| |||||||| |||||  |||||||||||||||||||||                                         a
3' auga gg aggcaggguuuuauucacgucg  au   auaag auggguug aaacu  caggcagaauaaacuuuuaaa                                         a
       u  -                      gc  -cu     c        c     ga                     acacuuuuuuaacuuuuauaaaucaguguguauuucaugau 
Get sequence
Deep sequencing
8943 reads, 2.2e+03 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 18223398-18223639 [+]
intergenic
Database links

Mature sequence osa-miR812q

Accession MIMAT0023255
Sequence

192 - 

acguuggguacgaauaucuacggc

 - 215

Get sequence
Deep sequencing392 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).