Stem-loop sequence osa-MIR812p

AccessionMI0019799 (change log)
DescriptionOryza sativa miR812p stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812p
(16 sentences)

Stem-loop
                         u   c     a                     c              aaaaaaaugaaaaaguaagucacguauaaaguacuau 
5' ccuauuuuaagugcagccauga uuu cgugc caacuuuaaucguccguuuua uugaauuuuuuuug                                     u
   |||||||||||||||||||||| ||| ||||| ||||||||||||||||||||| ||||||||||||||                                      
3' ggguaaaauucacguugguauu aaa guacg guugaaauuagcaggcagaau aacuuaaaaaaaau                                     c
                         c   a     g                     a              auuaaacguaaaaauaacaauacccuacuauuuuaua 
Get sequence
Deep sequencing
4629 reads, 700 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 25425998-25426211 [+]
intergenic
Database links

Mature sequence osa-miR812p

Accession MIMAT0023254
Sequence

164 - 

gacggacgauuaaaguugggcaug

 - 187

Get sequence
Deep sequencing3098 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).