Stem-loop sequence osa-MIR5788

AccessionMI0019798 (change log)
DescriptionOryza sativa miR5788 stem-loop
Literature search

5 open access papers mention osa-MIR5788
(10 sentences)

Stem-loop
          -    u    a               cu       a             ga 
5' aaaaaaa cgau cuag acuggaugugacaua  cuaguac augaaucuggaua  g
   ||||||| |||| |||| |||||||||||||||  ||||||| |||||||||||||   
3' uuuuuuu guua gauc ugaccuacacuguau  gaucaug ugcuuagaccuau  g
          a    -    a               ag       a             au 
Get sequence
Deep sequencing
2714 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 30006944-30007059 [+]
intergenic
Database links

Mature sequence osa-miR5788

Accession MIMAT0023253
Sequence

20 - 

uggaugugacauacucuagua

 - 40

Get sequence
Deep sequencing462 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).