Stem-loop sequence gma-MIR399h

AccessionMI0019796 (change log)
DescriptionGlycine max miR399h stem-loop
Gene family MIPF0000015; MIR399
Literature search

15 open access papers mention gma-MIR399h
(87 sentences)

Stem-loop
   c        a        c      cc       agaaaaa   cagc        a 
5'  aaaucagc auagggca cucucu  uggcagg       gau    auuuuugg g
    |||||||| |||||||| ||||||  |||||||       |||    |||||||| u
3'  uuuggucg ugucccgu gagagg  accguuc       cug    ugaaaacc u
   -        g        u      aa       --aauaa   ugac        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 36742439-36742552 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399h
gma-MIR399lchr9: 36735539-36735666 [+]
gma-MIR399hchr9: 36742439-36742552 [+]
Database links

Mature sequence gma-miR399h

Accession MIMAT0023251
Sequence

84 - 

ugccaaaggagaguugcccug

 - 104

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2