Stem-loop sequence gma-MIR169u

AccessionMI0019794 (change log)
DescriptionGlycine max miR169u stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169u
(96 sentences)

Stem-loop
   ucuugua   c     ag a          uua    u   uuggcauuauuauuaugaugaagaccua 
5'        gug agcca  g ugacuugccg   aacu guu                            c
          ||| |||||  | ||||||||||   |||| |||                            u
3'        cac ucggu  c acugaacggc   uuga caa                            u
   ccgguaa   a     cu a          caa    u   ucguauauauccuuguacuaccguacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 45847295-45847435 [-]
intergenic
Database links

Mature sequence gma-miR169u

Accession MIMAT0023249
Sequence

11 - 

cagccaaggaugacuugccgu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).