Stem-loop sequence gma-MIR166m

AccessionMI0019792 (change log)
DescriptionGlycine max miR166m stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166m
(209 sentences)

Stem-loop
   ---uuucguugc      ga   -  a a      uu      cu  -a     -----------  gagg      agaguauugagaugaguga 
5'             aaaggu  ggu ug g ggaaug  gucugg  cg  gguca           ug    aggagg                   a
               ||||||  ||| || | ||||||  ||||||  ||  |||||           ||    ||||||                    
3'             uuuuca  cca ac c ccuuac  cggacc  gc  uuagu           ac    uucucc                   a
   uccuuauuuuuu      ac   c  - -      uu      ag  gc     uaaaaaaaaaa  acaa      cauuuaaagguaaccuuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 36469526-36469701 [+]
intergenic
Database links

Mature sequence gma-miR166m

Accession MIMAT0023247
Sequence

132 - 

cggaccaggcuucauucccc

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).