Stem-loop sequence gma-MIR395g

AccessionMI0019791 (change log)
DescriptionGlycine max miR395g stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395g
(70 sentences)

Stem-loop
   g     cu  ug         ug          -ac   -------      gag a     a   ua 
5'  guugu  cu  gaguuccuc  aacacuucac   gug       ggacua   u guggu uug  u
    |||||  ||  |||||||||  ||||||||||   |||       ||||||   | ||||| |||  c
3'  caaca  ga  uucaagggg  uugugaagug   cac       ccugau   g uacua gau  c
   -     ug  uu         gu          aac   uacuacu      -aa a     -   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 41445444-41445571 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395g
gma-MIR395gchr8: 41445444-41445571 [-]
gma-MIR395fchr8: 41439069-41439190 [-]
Database links

Mature sequence gma-miR395g

Accession MIMAT0023246
Sequence

98 - 

ugaaguguuugggggaacuuu

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).