Stem-loop sequence gma-MIR395f

AccessionMI0019790 (change log)
DescriptionGlycine max miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395f
(70 sentences)

Stem-loop
   gc   cu  ug         ug         -cg -   ----      g      uc  uau 
5'   ugu  cu  gaguuccuc  agcacuuca   c gug    gggcua uucuau  aa   u
     |||  ||  |||||||||  |||||||||   | |||    |||||| ||||||  ||   a
3'   aca  gg  uucaagggg  uugugaagu   g cac    ccugau aagaua  uu   c
   ca   ug  uu         gu         aaa u   uacu      -      ga  uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 41439069-41439190 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395f
gma-MIR395gchr8: 41445444-41445571 [-]
gma-MIR395fchr8: 41439069-41439190 [-]
Database links

Mature sequence gma-miR395f

Accession MIMAT0023245
Sequence

92 - 

ugaaguguuugggggaacuuu

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).