Stem-loop sequence gma-MIR395e

AccessionMI0019789 (change log)
DescriptionGlycine max miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395e
(70 sentences)

Stem-loop
   gc   cu  ug         ug          ----gaau   cua           uau 
5'   ugu  cu  gaguuccuc  agcacuucac        gac   guucuauuugg   u
     |||  ||  |||||||||  ||||||||||        |||   |||||||||||   a
3'   aca  gg  uucaagggg  uugugaagug        cug   uaagauagauu   c
   ca   ug  uu         gu          aauauauu   --a           ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 41424558-41424674 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395e
gma-MIR395echr8: 41424558-41424674 [-]
gma-MIR395dchr8: 41415505-41415625 [-]
Database links

Mature sequence gma-miR395e

Accession MIMAT0023244
Sequence

87 - 

ugaaguguuugggggaacuuu

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).