Stem-loop sequence gma-MIR395d

AccessionMI0019788 (change log)
DescriptionGlycine max miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

15 open access papers mention gma-MIR395d
(70 sentences)

Stem-loop
   gc   cu  ug         ug          guacg  ugu     g      u   uau 
5'   ugu  cu  gaguuccuc  agcacuucac     ug   ggcua uucuau cug   u
     |||  ||  |||||||||  ||||||||||     ||   ||||| |||||| |||   a
3'   aca  gg  uucaagggg  uugugaagug     au   cugau aagaua gau   c
   ca   ag  cu         gu          aauua  --u     -      -   ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 41415505-41415625 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR395d
gma-MIR395echr8: 41424558-41424674 [-]
gma-MIR395dchr8: 41415505-41415625 [-]
Database links

Mature sequence gma-miR395d

Accession MIMAT0023243
Sequence

91 - 

ugaaguguuugggggaacuuu

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).