Stem-loop sequence gma-MIR171u

AccessionMI0019785 (change log)
DescriptionGlycine max miR171u stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171u
(36 sentences)

Stem-loop
   u     ----        a  a         a      -uu   u   g   g 
5'  guggg    gauguugg ac guucaauca aucaaa   ucc aau auu g
    |||||    |||||||| || ||||||||| ||||||   ||| ||| |||  
3'  caucc    cuauaacc ug cgaguuagu uaguuu   agg uug uag g
   u     uuaa        g  c         a      cuu   -   g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 923816-923917 [-]
intergenic
Database links

Mature sequence gma-miR171u

Accession MIMAT0023240
Sequence

72 - 

ugauugagccgugccaauauc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).