Stem-loop sequence gma-MIR394f

AccessionMI0019784 (change log)
DescriptionGlycine max miR394f stem-loop
Gene family MIPF0000100; MIR394
Literature search

8 open access papers mention gma-MIR394f
(12 sentences)

Stem-loop
   -  u    au      auu   u         cuaauauuaaa  g 
5'  cg agcc  uuuggc   cug ccaccucca           ug u
    || ||||  ||||||   ||| |||||||||           ||  
3'  gu ucgg  aaaccg   gac gguggaggu           ac g
   u  c    gc      gau   c         ---------ug  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 9871233-9871316 [+]
intergenic
Database links

Mature sequence gma-miR394f

Accession MIMAT0023239
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).