Stem-loop sequence gma-MIR171t

AccessionMI0019781 (change log)
DescriptionGlycine max miR171t stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171t
(36 sentences)

Stem-loop
   gaagugcuguaugaagcacaaauca             c       u   g -       aaca 
5'                          agguauuggcgcg cucaauu gaa u caugguu    u
                            ||||||||||||| ||||||| ||| | |||||||    g
3'                          ucuauaacugcgc gaguuaa uuu a guaccga    a
   -------------uucacguucuac             c       u   g u       acaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 49564865-49564981 [-]
intergenic
Database links

Mature sequence gma-miR171t

Accession MIMAT0023236
Sequence

87 - 

uugagccgcgucaauaucuca

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).