Stem-loop sequence gma-MIR166l

AccessionMI0019780 (change log)
DescriptionGlycine max miR166l stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166l
(210 sentences)

Stem-loop
   ---uuuccuu        ga  u  a a      uu      -    ag    ----------------   ----      agaguacucagaugaguga 
5'           gcaaaggu  gg ug g ggaaug  gucugg cucg  guca                ugg    aggagg                   a
             ||||||||  || || | ||||||  |||||| ||||  ||||                |||    ||||||                    
3'           uguuuuca  cc ac c cuuuac  cggacc gggu  uagu                acc    uucucc                   a
   ccuuauuuuu        -a  u  c c      uu      a    cu    uaaaaaaaaaaaaaaa   acaa      cauuuaaagguaaccuuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 45680685-45680863 [-]
intergenic
Database links

Mature sequence gma-miR166l

Accession MIMAT0023235
Sequence

26 - 

ggaauguugucuggcucgagg

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).