Stem-loop sequence gma-MIR171s

AccessionMI0019779 (change log)
DescriptionGlycine max miR171s stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

15 open access papers mention gma-MIR171s
(36 sentences)

Stem-loop
   g     g     c         c   u    a    ugcauau  auuuaa 
5'  aagug acugg gugguauug uuc guuc ucuu       ga      u
    ||||| ||||| ||||||||| ||| |||| ||||       ||       
3'  uucac ugauc caccauaac aag cgag agaa       cu      c
   -     a     u         u   c    c    -uaaauu  ccuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 10887673-10887774 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR171s
gma-MIR171hchr6: 10887944-10888094 [-]
gma-MIR171schr6: 10887673-10887774 [-]
Database links

Mature sequence gma-miR171s

Accession MIMAT0023234
Sequence

72 - 

cgagccgaaucaauaccacuc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).