Stem-loop sequence gma-MIR169t

AccessionMI0019778 (change log)
DescriptionGlycine max miR169t stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

24 open access papers mention gma-MIR169t
(98 sentences)

Stem-loop
   u     cu       a    u  a      uaacuauu   uu uac   a      uuaauuaa 
5'  caugu  gguagcc agga gg cuugcc        cca  c   ggg cuuuau        u
    |||||  ||||||| |||| || ||||||        |||  |   ||| ||||||         
3'  guacg  uuaucgg uccu uc gaacgg        ggu  g   ccc gaagua        u
   c     -u       c    -  -      --uuaaau   uu -uu   a      uacucugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 38544108-38544233 [+]
intergenic
Database links

Mature sequence gma-miR169t

Accession MIMAT0023233
Sequence

11 - 

uagccaaggauggacuugccua

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).